You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
ktrC [2020-06-03 10:44:53]
glutamate-controlled potassium channel
KtrC-
KtrD, peripheric membrane component
Molecular weight
24.20 kDa
Product
glutamate-controlled potassium channel
KtrC-
KtrD, peripheric membrane component
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,520,531 1,521,196
The protein
Protein family
KtrA potassium transport family (with KtrA, according to UniProt) Paralogous protein(s)
Kinetic information
the KtrC-KtrD channel has a low affinity for potassium, this is determined by KtrD PubMedthe affinity of KtrC-KtrD for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) PubMed Domains
Effectors of protein activity
binds ADP and ATP PubMedthe protein binds c-di-AMP, KD = 30 nM, this results in inhibition of potassium uptake PubMedthe affinity of KtrC-KtrD for potassium is strongly increased in the presence of glutamate PubMed Structure
Localization
peripheral membrane protein PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A904 (ykqB::erm), available at the NBRP B. subtilis, JapanGHB6 (ktrC::spec), PubMed (available in Erhard Bremer's and Jörg Stülke's) labs, available at BGSC as 1A955GP2264 (ΔktrC::aphA3), available in Jörg Stülke's lab PubMedGP2048 (ΔktrC::cat), available in Jörg Stülke's lab PubMedGP2079 (ΔktrC::tet), available in Jörg Stülke's lab PubMedGP2771 (ΔktrC::spec), available in Jörg Stülke's labGP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMedBKE14510 (ktrC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTCBKK14510 (ktrC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC Expression vector
pGP2994: expression of Strep-KtrC in B. subtilis suitable for SPINE (based on pGP380), available in Jörg Stülke's labpGP2995: expression of KtrC-Strep in B. subtilis suitable for SPINE (based on pGP382), available in Jörg Stülke's lab Expression vectors
pGP2907 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading